HIGH RESOLUTION GENETIC FOOTPRINTING

This web site was designed to provide detailed protocols for genetic footprinting, a technique for high-resolution mapping of the functional organization of cloned genes (Singh, Crowley and Brown (1997) PNAS 94: 1304-1309). See below for an introduction to high-resolution genetic footprinting, as well as a collection of current protocols. Comments or questions about this site should be directed to Rachel Crowley (rachel@cmgm.stanford.edu). The Yeast Genome Center at Stanford University is applying genetic footprinting on a genome-wide scale, with the goal of obtaining functional information for all of the ORFs in the Saccharomyces cerevisiae genome (described in Smith et al. (1996) Science 274: 2069-2074 and Smith, Botstein, and Brown (1995) PNAS 92: 6479-6483.) See the Brown lab home page for more information about genetic footprinting of the yeast genome. INTRODUCTION TO GENETIC FOOTPRINTING Genetic footprinting is a technique for high-resolution mapping of the functional organization of a cloned gene. An in vitro transposition reaction with purified retroviral integrase is used to generate a large library of mutants, each of which bears an insertion or block substitution mutation of defined sequence at some position within the gene. The library of mutants is simultaneously subjected to one or more genetic selections, and DNA is made from the library of mutants before and after selection. The presence or absence of individual mutants within each population is determined by PCR analysis, in which each mutant within the library gives rise to a PCR product of unique electrophoretic mobility. Comparison of PCR product bands before and after selection allows reconstruction of the features of the gene that are essential for the function that has been selected. For more information, see Singh, Crowley and Brown (1997) PNAS 94: 1304-1309. MATERIALS REQUIRED 1.) A construct containing the gene to be mutagenized, and lacking recognition sites for the restriction enzymes that are used in the mutagenesis procedure (typically, Not I and Bsg I).This mutagenesis protocol requires that the construct be no larger than 2.5 kb, so it may be necessary to subdivide the region of interest into smaller parts for the mutagenesis. The piAN13 vector, which is 894 bp and carries the supF gene as a selectable marker, is our vector of choice for mutagenesis. To obtain the piAN13 vector and the strain for selection of this vector, send a request by email to molsen@cmgm.stanford.edu.If the construct to be mutagenized contains recognition sites for Not I and/or Bsg I, these can be removed by site directed mutagenesis. Alternatively, the genetic footprinting strategy can be designed around other enzymes (see section 3 below for design of alternative substrates).2.) MLV integrase enzyme.Moloney Murine Leukemia Virus Integrase (MLV IN) is purified as a fusion to glutathione S-transferase. A single-step glutathione agarose affinity purification generates enzyme of sufficient purity for the mutagenesis. A detailed protocol for this purification, including the materials required, is found below. For the MLV integrase expression strain, send a request by email to molsen@cmgm.stanford.edu.3.) Oligonucleotide substrates for MLV integrase.Our oligonucleotide substrate of choice contains restriction sites for the enzymes Not I (for making in-frame, 12-amino acid insertion mutants) and Bsg I (for making 4-amino acid block substitution mutants). In order to use these sites for mutagenesis, the target construct must not contain recognition sites for Not I or Bsg I. For more information on design of suitable alternative viral end substrates see note [1] in the appendix.This oligonucleotide substrate for MLV IN is made by annealing two oligonucleotides:MLVNotBsgB 5'-AATGAAAGCTGCACGCGGCCGCATTCTTAT-3'MLVNotBsgG 5'-ATAAGAATGCGGCCGCGTGCAGCTTTCA-3'A third ｉｎｓｅｒｔ-specific oligonucleotide is needed for PCR analysis of insertional mutants: 5'-GGCCGCGTGCAGCTTTCA-3'.4.) Commercially available enzymes: restriction enzyme(s) used for mutagenesis (e.g., Not I, Bsg I), T4 DNA ligase, T4 polynucleotide kinase. All enzymes were obtained from New England Biolabs.5.) PCR Thermal Cycler and PCR consumables. We use a Perkin-Elmer 9600 thermal cycler with thin-walled 0.2 ml tubes, and AmpliTaq polymerase from Perkin-Elmer.6.) Materials for preparative agarose gel electrophoresis. We use the Quiaquick gel extraction kit (Qiagen) for all band excision steps, and the Quiaquick PCR purification kit (Qiagen) for removal of enzyme when gel purification is not required.7.) Materials for denaturing polyacrylamide sequencing gel electrophoresis.8.) PCR primers complementary to the sequence being mutagenized. A good rule of thumb is one primer for every 200 nucleotides to be footprinted. We aim for a primer Tm of near 72 C, so that PCRs can be done by two step cycling (without an annealing step).9.) Radioisotopes. Detection of footprinting PCR products is done by end-labeling PCR primers with gamma-32P-ATP, and PCR products are sized by comparison to control sequencing ladders made with alpha-35S-ATP. PURIFICATION OF MLV INTEGRASE MATERIALSpGEX3XMLVIN (in DH5alpha)Luria Broth (LB): 10.5 Lfive 6L flasks50 mg/ml carbenicillin (10.5 ml)IPTG (595 mg), SigmaVarious buffer components (make sure there is DTT, reduced glutathione, autoclaved 80% glycerol, protease inhibitors, etc.)lysozymeprotease inhibitors: PMSF, pepstatin A, leupeptin, antipain, aprotinin0.45 um syringe filters (about 15)1 ml and 10 ml syringesglutathione-agarose resin (attached through the sulfur, Sigma G4510)G-15 SephadexColumns (I.D. 15 mm)Connectors, tubing, gradient maker, stir-plate, peristaltic pumpSterile 1.5 ml screw capped tubes, 1.5 ml microcentrifuge tubes, 0.5 ml tubes for aliquoting enzyme10% SDS-PAGE gels (enough for approximately 30 lanes)15% Acrylamide-urea gels (enough for approximately 50 lanes)Coomassie stain (40% methanol/10% acetic acid/0.5% Coomassie Brilliant Blue), destain (40% methanol/10% acetic acid)Bradford reagent for protein assays (Biorad)SonicatorSW28 rotor, ultracentrifugeice, liquid nitrogen, -80°C freezerBUFFERS AND SOLUTIONSNB: Use autoclaved stock solutions of Tris, EDTA, NaCl, Glycerol, and Hepes.Just before use, add DTT, reduced glutathione, and protease inhibitors where indicated, then pass through 0.2 um filter.100 mM IPTG stock solution (MW=238.3)595 mg IPTG25 ml waterTEN Buffer, 1 liter final volume(final concentration, amount of stock added to make 1 L solution)10 mM Tris pH 8.0, 10 ml of 1 M stock1 mM EDTA pH 8.0, 2 ml of 0.5 M stock100 mM NaCl, 20 ml of 5 M stockwater, 968 mlLysis Buffer, 250 ml final volume(final concentration, amount of stock added to make 250 ml solution)50 mM Tris pH 8.0, 12.5 ml of 1 M stock10 mM EDTA, 5 ml of 0.5 M stock140 mM NaCl, 7 ml of 5 M stock10% glycerol, 31.25 ml of 80% stock10 mM DTT, 385 mg1 mM PMSF, 4.35 ml of 10 mg/ ml stock in ethanol1 ug/ml pepstatin A, 250 ul of 1 mg/ml stock in methanol10 ug/ml leupeptin, 250 ul of 10 mg/ml stock in water1 ug/ml antipain, 25 ul of 10 mg/ml in water1 ug/ml aprotinin, 25 ul of 10 mg/ml in waterwater, 189.4 mlBuffer A, 100 ml final volume(final concentration, amount of stock added to make 100 ml solution)50 mM Tris pH 7.5, 5 ml of 1 M stock100 mM NaCl, 2 ml of 5 M10% glycerol, 12.5 ml of 80% stock0.5% NP-40, 5 ml of 10% stock10 mM DTT, 154 mgwater, 75.5 mlBuffer B, 100 ml final volume(final concentration, amount of stock added to make 100 ml solution)50 mM Tris pH 7.5, 5 ml of 1 M stock100 mM NaCl, 2 ml of 5 M10% glycerol, 12.5 ml of 80% stock0.05% NP-40, 0.5 ml of 10% stock10 mM DTT, 154 mgwater, 80.0 mlBuffer C, 100 ml final volume(final concentration, amount of stock added to make 100 ml solution)50 mM Tris pH 7.5, 5 ml of 1 M stock100 mM NaCl, 2 ml of 5 M10% glycerol, 12.5 ml of 80% stock0.05% NP-40, 0.5 ml of 10% stock10 mM reduced glutathione, 155 mgwater, 80.0 ml2X MLV IN Reaction Buffer, 1 ml final volume40 mM MOPS pH7.2, 40 ul of 1 M stock150 mM KCl, 150 ul of 1 M stock20 mM DTT, 20 ul of 1 M stock100 ug/ml Bovine serum albumin, 10 ul of 10 mg/ml stock40% glycerol, 500 ul of 80% stockwater, 280 ulDAY 1: Grow small-scale bacterial culture overnight.[Total work time = few minutes]250 ml LB + 250 ul of 50 mg/ml carbenicillin + a colony of pGEX3XMLVIN (in DH5alpha). Grow overnight at 37 C.DAY 2: Large-scale growth and induction of Integrase expression, prepare viral substrate for activity assays, pour gels.[Total work time = 11 hours or so. Hands on time = 5 hrs or so]2L X 5 LB in 6L flasks warmed to 30 C.Add 2 ml of 50 mg/ml carbenicillin/flask and 40 ml of overnight culture.Grow with shaking (250 rpm) at 30 C till O.D.600 is 0.8 (takes around 6 - 6.5 hours).Meanwhile, prepare viral substrate (see below), pour gels (see below), autoclave tubes.Add 5 ml of 100 mM IPTG to each 2 L flask, when cultures reach O.D.600 of 0.8.Grow for additional 3 hrs at 30 C.Transfer to ice.Spin down cells: Pour cultures into 6 X 1 L bottles that fit in Sorvall H6000A rotor. 4500 rpm for 30 min at 4 C. Discard supernatant. Refill same bottles with more cultures Repeat spin. Discard supernatant.Wash pellet with TEN buffer. Resuspend each pellet in 20 ml TEN completely. Pool into two 250 ml centrifuge bottles. Bring final volume in each to 250 ml with TEN.Spin at 6000 rpm for 10 min at 4 C.Discard supernatant. Place bottles in -80 C (no liquid nitrogen).Prepare viral substrate. This involves radiolabeling oligonucleotides and annealing them to generate viral DNA ends that can be used to assay activity of fractions from the column. We use oligonucleotides A194 (5'-ACCTACAGGTGGGGTCTTTCATT-3') and A193 (5'-AATGAAAGACCCCACCTGTAGGT-3') for measuring end processing and joining activities. Oligonucleotides used to measure disintegration activity are MLVDISIN-2 (5'-CGCAAGCGCC-3') and MLVDISIN-1 (5'AATGAAAGTTCTTTCAGGCCGCAGGTCTTGACCTGCGGCCGGCGCTTGCG-3').Kinase oligonucleotide substrate, 100 ul final reaction volume1 ul of 100 uM oligonucleotide A194 or MLVDISIN-2 (100 pmol oligonucleotide)10 ul gamma-32P-ATP (100 uCi)10 ul 10X kinase buffer5 ul T4 polynucleotide kinase (50 U) [New England Biolabs]74 ul waterIncubate 37 C for 1 hr. Incubate 65 C for 20 min to heat inactivate kinase.Run over a G-15 Sephadex spin column to get rid of free label.Anneal to unlabeled second oligonucleotide:all of above labeled oligonucleotide+ 1 ul 100 uM second oligonucleotide+11 ul 500 mM NaClHeat to 95 C for 2 min. Cool over 1 hr to 20 C.Store shielded at 4 C.Pour SDS-PAGE gels.30% Acrylamide (37:1)4X Resolving Gel Buffer1.5 M Tris, 18.17 g0.4% SDS, 4 ml of 10%Water, qs to 100 mlpH to 8.8 with HClFilter4X Stacking Gel Buffer0.5 M Tris, 6.06 g0.4% SDS, 4 ml of 10%Water, qs to 100 mlpH to 6.8 with HClFilter6X Protein Sample buffer 4X Stacking Gel Buffer, 7 mlGlycerol, 4.5 ml of 80%SDS, 1 gDTT, 0.93 gBromophenol Blue, 1.2 mgWater, qs to 10 mlFilterStore at -20 C5X SDS Running Buffer Tris Base, 15.1 gGlycine, 72 gSDS, 5 gWater, qs to 1000 mlStain10% Acetic Acid20% Methanol0.5% Coomassie Brilliant BlueFilterFix/Destain10% Acetic Acid20% MethanolResolving Gel4X Resolving Gel Buffer, 4.0 ml30% Acrylamide, 5.3 mlWater, 6.7 ml10% APS, 80 ulTEMED, 15 ulStacking Gel4X Stacking Gel Buffer, 2.5 ml30% Acrylamide, 1.5 mlWater, 6.0 ml10% APS, 30 ulTEMED, 30 ulPour Acrylamide-urea Sequencing gels.Glycerol-tolerant (TTE) gel running buffer is used because MLV IN reaction buffer contains 20% glycerol.20X TTE bufferTris Base, 216 gTaurine, 72 gEDTA disodium salt, 4 gqs to 1 liter, filter15% denaturing sequencing gel (per 1 gel, with extra for spillage)urea, 42 g20X TTE, 5 ml40% acrylamide (19:1), 37.5 mlwater, qs to 100 mlMicrowave 30 sec and stir to dissolve urea, 0.45 um filter. Prepare sequencing gel plates while mix is cooling. To initiate polymerization, add 400 ul of 10% ammonium persulfate and 60 ul of TEMED.DAY 3: Lysis of cells, glutathione-agarose (GA) column.[Total work time = all day and night (the column needs babysitting). Hands on time: several hours.]Lysis of cellsResuspend cells in 200 ml Lysis Buffer.Add lysozyme to 1 mg/ml.Ice 1 hr.Aliquot into 50 ml Falcon tubes (~40 ml/tube).Freeze in liquid nitrogen/thaw in 37 C water bath. Invert tubes periodically while thawing. Freeze/thaw three times.Sonicate 5 x 30 sec, full power, medium tip (tip diameter 6 mm), on ice, moving the tube up and down.Spin at 105,000 x g 30 min in SW28 rotor (24,000 rpm). Toss pellet.Filter supernatant through 0.45 um syringe filters.Add NP-40 to 0.5%.Swelling and Equilibrating Glutathione-agarose columnSwell 425 mg glutathione-agarose in Buffer A (85 mg dry powder swells to approximately 1 ml column volume)Transfer swelled resin into column.Wash with 50 ml (10 volumes) of Buffer A.Running Glutathione-agarose columnNB: Column is run entirely by gravityLoad the cleared and filtered cell lysate onto equilibrated column. This will take about 10-12 hours. Save the flow.Wash with 50 ml (10 volumes) Buffer B.Elute with 30 ml (6 volumes) Buffer C. Collect 1.5 ml fractions (20 fractions).Bradford AssaysDilute concentrated Bradford reagent 1:5 with water. Filter through 0.45 um.Aliquot 1 ml diluted reagent per sample.Make up quantitation standards (0, 1, 2, 4, 8, 16 ug BSA).Assay 5 ul of each fraction.Protein peak is usually seen in fractions 5-8.SDS/PAGE of protein fractionsRun ~5 ug of load, flow, wash, and each fraction. Stain with Coomassie. Destain. GST-Integrase runs around 72 kD and free GST at 26 kD.DAY 4: Activity assays on fractions from the GA column, aliquot.Activity Assays on Fractions.Assemble two master mixes (one each for integration and disintegration substrates) with the appropriate multiple of the following components.2X MLV IN buffer, 5 ul50 mM MnCl2, 1 ullabeled substrate, 1 ul (0.5 - 1 pmol)water, 2 ulAliquot 9 ul of mix to each tube (remember to include a no enzyme control). Add 1 ul of fraction and pipet up and down to mix. Incubate at 37 C for 30 min While reactions are incubating, prerun 15% denaturing polyacrylamide gel (65 W for 30 min). To stop reactions and denature products, add 10 ul of formamide loading dye (95% deionized formamide, 20 mM ETDA, 0.05% xylene cyanol, 0.05% bromophenol blue). Heat samples to 90 C for 3 min and load 5-10 ul per lane on prewarmed gel. Run gel for 2 hours at 65 W. Remove gel from plate and cover both sides with Saran Wrap. Mark the orientation of the gel, and expose wet gel to Kodak XAR-5 film for 1-2 hours at -40 C.For the disintegration reaction, the expected product is larger than the starting material and thus easily distinguished from potential nuclease contaminants. The peak of integrase activity is typically in fractions 4-6. For photographs of activity assay gels, see Dotan et al. J. Virology 69(1): 456-468. GENERATION OF INSERTIONAL MUTANTS MATERIALS REQUIRED FOR INTEGRATION REACTIONSMLV Integrase (MLV IN). See attached enzyme purification protocol.Viral end oligonucleotide duplex substrate:(Sequence can be varied depending on features desired - see note [1] of the appendix for information on designing appropriate alternative viral end oligonucleotides.) The sequence of our oligonucleotide duplex of choice is shown below.MLVNotBsgB 5'-AATGAAAGCTGCACGCGGCCGCATTCTTAT-3'MLVNotBsgG 5'-ATAAGAATGCGGCCGCGTGCAGCTTTCA-3'Plasmid containing target gene (1 mg/ml)DNA must have a minimal amount of nicked circle present in prep. We routinely use Qiagen maxiprep DNA for integration target.2X MLV IN buffer (Store in aliquots at -20 °C)40 mM MOPS pH7.2, 40 ul of 1 M stock150 mM KCl, 150 ul of 1 M stock20 mM DTT, 20 ul of 1 M stock100 ug/ml Bovine serum albumin, 10 ul of 10 mg/ml stock40% glycerol, 500 ul of 80% stockwater, 280 ul50 mM MnCl24 M NaCl5X Integration Stop buffer (Store in aliquots at room temp)15% Ficoll (Type 400; Pharmacia)2.5% SDS50 mM disodium EDTA0.25 % Bromophenol Blue0.25 % Xylene Cyanol10X Proteinase K stock (Store in aliquots at -20 °C)10 mM Tris500 ug/ml Proteinase K (Boehringer Mannheim)Boil for 10 minutes to destroy any nuclease contaminants, allow to cool to room temperature.MATERIALS REQUIRED FOR PCR (Store solutions in aliquots at -20 °C)10X PCR buffer 200 mM Tris-HCl (pH 8.55 at 25 C)160 mM (NH4)2SO41.5 mg/ml bovine serum albumin(Nonacetylated BSA, New England Biolabs)100x dNTP stock, 25 mM in each dNTP (Pharmacia)35 mM MgCl2AmpliTaq DNA polymerase (Perkin-Elmer)OTHER MATERIALS REQUIREDNot I restriction enzyme (New England Biolabs)T4 DNA ligase (New England Biolabs)Quiaquick Gel extraction kit (Quiagen)Quiaquick PCR purification kit (Quiagen)BEFORE STARTING THIS PROTOCOL, PLEASE SEE APPENDIX FOR DETAILED NOTES ON INDIVIDUAL STEPS. NOTES ARE REFERENCED THROUGHOUT THE PROTOCOL BY BRACKETED NUMBERS, e.g., [1], [2], etc.1) INTEGRATE INTO PLASMID CONTAINING TARGET GENEAnneal viral-end oligonucleotides:1 ul (100 pmol) MLVNotBsgG1 ul (100 pmol) MLVNotBsgB2 ul 500 mM NaClqs to 20 ul with TE buffer (10 mM Tris pH 8, 1 mM disodium EDTA)Heat to 95°C for 5 min, cool slowly to room temperature.Add 80 ul of TE buffer(Final concentration of annealed oligonucleotide= 1 pmol/ul = 1 uM)Form stable complex between integrase and viral end oligonucleotide:50 ul 2X MLV IN buffer10 ul 50 mM MnCl28 ul annealed viral end oligonucleotide (8. pmol)ul MLV integrase (12 pmol) - volume is variableqs to final volume of 85.5 ul.Incubate for 5 min at 37°C to form stable complex between integrase and viral end oligonucleotide.Integrate into target DNA:To above mixture, add 10 ul of 4 M NaCl, and 4.5 ul of target plasmid DNA, mix. Incubate at 37 C for 30 minStop integration and deproteinize reaction intermediates:Add 25 ul of integration stop buffer, and 13 ul of proteinase K stock solution. Incubate at 37 C for 30 minutes.2) GEL PURIFY CONCERTED INTEGRATION PRODUCTSee note [2] in the appendix.Prepare linearized target plasmid DNA, to be used as a size standard in gel purification of concerted integration product. To minimize aberrations in electrophoresis due to high salt in the integration samples, after digestion increase the salt concentration of the linear size standard to equal that of the integration reaction (0.4 M NaCl).Cast a 1% preparative agarose gel, approximately 14 cm long. We use SeaKem LE Agarose (FMC), 1X TBE gel running buffer. Load the integration product adjacent to the linearized and uncut size standards. The gel is run at 4-5 V/cm (based on interelectrode distance), until the expected product band is approximately 2/3 through the gel.Stain gel briefly with ethidium bromide. The concerted integration product should run slightly above the linearized size standard, as the two integrated viral end oligonucleotides make it larger than linearized plasmid by 56 bp. Carefully cut the region of the gel containing the concerted integration product, which migrates between the linearized plasmid and the nicked circle. Be careful to avoid the nicked circle.Extract the DNA from the gel slice using the Qiaquick gel extraction protocol, according to manufacturer's instructions (Qiagen). Elute DNA in 50 ul of 10 mM Tris.3) PCR AMPLIFY CONCERTED INTEGRATION PRODUCTSee notes [3] - [5] in appendix.10 ul 10X PCR buffer10 ul 35 MgCl21 ul dNTP mixture4 ul primer MLVNotBsgG (40 pmol)1 ul template (Qiaquick purified concerted integration product)0.5 ul Amplitaq (2.5 U)ul water - volume is variablefinal volume 100 ulThermocycling Conditions5 min at 72 C (strand displacement synthesis)2 min at 94 Cfollowed by 20-40 cycles of30 sec at 94 C1-2 min at 72 C (1 min sufficient for amplification of 2 kb product)Once the optimal conditions for PCR amplification of the concerted integration product have been determined, the PCR reaction should be scaled up approximately 10-fold to obtain ample amounts of this product for subcloning.If the concerted integration PCR product appears as a single clean band of expected size on an ethidium-stained agarose gel, the product can be purified over Qiaquick PCR purification column (Qiagen). A single column can be loaded many times in order to concentrate the sample.If the concerted integration PCR product has a small amount of smearing, the PCR product should be gel purified using the Qiaquick gel extraction kit as described above.4) RESTRICTION ENDONUCLEASE DIGESTION OF CONCERTED INTEGRATION PRODUCTEstimate the concentration of the purified PCR product by minigel.Digest PCR product with 20-fold excess of enzyme units per ug DNA. Overnight digestion in manufacturer-supplied buffer (New England Biolabs) is recommended for end-cutting, unless the enzyme is known to be relatively impure, as is the case for type IIS endonucleases. Remove restriction enzyme and change to ligase buffer either by (1) extraction with phenol: chloroform: isoamyl alcohol and precipitation with ethanol or (2) purification over Qiaquick PCR purification column.5) LIGATE TO RECIRCULARIZE INSERTIONAL MUTANTSEstimate the concentration of purified DNA by minigel. To promote intramolecular rather than intermolecular events, ligations are performed at a dilute DNA concentration. The desired DNA concentration can be determined from the following formula: y = [1900 / c * (bp)exp0.5], where c is the concentration of DNA in ng/ul, and bp is the length of the DNA in basepairs. Intramolecular ligation is favored when c is chosen such that y>>1. We have found that y values of 10 give a good transformation efficiency. To obtain maximum transformation efficiency, set up a few test ligations with different DNA concentrations.Ligation Reaction (100 ul final volume)10 ul 10X T4 ligase buffer (New England Biolabs)ul purified, restriction-digested PCR product (50-100 ng) - volume is variable1 ul T4 DNA ligase (12.5 Weiss units - New England Biolabs)Incubate ligation for 12-18 hours at 16 C. Heat inactivate ligations at 65 C for 10 minutes.Transform/transfect mutants and subject to appropriate selections. Prepare DNA corresponding to the populations of mutants with and without selection for the gene that has been mutagenized. NB: Efficiency of transformation can be increased by phenol:chloroform extraction and ethanol precipitation of ligations prior to transformation. GENERATION OF SUBSTITUTION MUTANTS See notes [6] - [8] in appendix.NB: This protocol for making 4-amino acid block substitution mutants requires that the replacement oligonucleotide contain a unique restriction site. An alternative protocol for making substitution mutants, which does not require the presence of a unique site within the replacement oligonucleotide, is being developed and will be made available at this site at a later date.MATERIALSInsertional mutant library, made as described in the section "Generation of Insertional Mutants." Grow plasmid DNA corresponding to the insertional mutant library that is unselected with respect to your gene of interest.Replacement oligonucleotide of desired sequence.The replacement used for supF was designed to add a unique Nde I restriction site. The sequence of this self-complementary oligonucleotide is 5'-TAGCATATGCTANN, where N represents an equal mixture of the four deoxynucleotides.Enzymes and buffers (New England Biolabs):Bsg I restriction endonuclease - supplied with S-adenosylmethionineNdeI restriction endonucleaseT4 Polynucleotide KinaseT4 DNA ligaseATP stock solution (10 mM)1) DIGEST INSERTIONAL MUTANT LIBRARY WITH BSG I15 ul 10X New England Biolabs restriction buffer 40.4 ul S-adenosylmethionine (32 mM stock, New England Biolabs)ul 3 ug DNA, unselected insertional mutant library - volume is variable13 ul Bsg I enzyme (20 U, New England Biolabs)qs to 150 ul final volume.Incubate digest at 37 C for 1-2 hours, adding 0.4 ul of S-adenosylmethionine to the reaction every 20 minutes. Longer digestion times are not recommended because the Bsg I enzyme is relatively impure. Heat inactivate digest at 65 C for 20 minutes. Extract with phenol:chloroform:isoamyl alcohol and precipitate with ethanol.To achieve complete digestion with Bsg I, a second identical round of Bsg I digestion and phenol:chloroform extraction is needed.2) SELF-ANNEAL REPLACEMENT OLIGONUCLEOTIDE2 ul replacement oligonucleotide (200 pmol)16 ul TE buffer2 ul 500 mM NaClHeat to 95 C for 5 min, and cool slowly to room temperature. Final conc. of annealed oligonucleotide is 5 uM.3) LIGATE PLASMID TO REPLACEMENT OLIGONUCLEOTIDE5 ul 10X T4 ligase bufferul Bsg I-digested library DNA (500 ng=approx. 0.5 pmol) - volume is variable8.0 ul kinased, annealed replacement oligonucleotide (40-50 pmol)1 ul T4 ligase (12 Weiss units, New England Biolabs)50 ul final reaction volumeIncubate ligation at 16 C for 18 hours. Heat inactivate ligase 65 C for 10 minutes. Extract ligation with phenol:chloroform:isoamyl alcohol and precipitate with ethanol.4) FILL IN WITH TAQ POLYMERASE10 ul 10x PCR buffer10 ul 35 mM MgCl21 ul 100x dNTPs stock78.5 ul ligated DNA0.5 ul Amplitaq polymeraseFinal volume 100 ul. Incubate 10 minutes at 72 C to fill in.Purify reaction product either by Quiaquick PCR purification kit or by phenol:chloroform followed by ethanol precipitation.5) DIGEST LIGATION PRODUCTS WITH NDE I20 ul 10 X NEB buffer 4ul phenol-extracted, ligated DNA - volume is variable5 ul Nde I enzyme (100 U)200 ul final volume.Incubate at 37 C for 30 min to 1 hour (half-life of Nde I enzyme is 15 minutes at 37 C.) After digestion, cleaved excess oligonucleotide was removed with Qiaquick PCR purification kit (Qiagen).5) RECIRCULARIZE MOLECULES BY LIGATIONEstimate concentration of purified DNA by minigel. To determine the proper DNA concentration for ligations, refer to the formula in the "Generation of Insertional Mutants" section, under step (5) "Ligate to recircularize insertional mutants."Ligation Reaction (100 ul final volume)10 ul 10X T4 ligase buffer (New England Biolabs)ul purified, restriction-digested DNA (50-100 ng DNA)1 ul T4 DNA ligase (12.5 Weiss units - New England Biolabs)Incubate ligation for 12 hours at 16 C. Heat inactivate ligation for 10 minutes at 65 C.Transform/transfect mutants and subject to appropriate selections. Prepare DNA corresponding to the populations of mutants with and without selection for the gene that has been mutagenized. ANALYSIS OF INSERTIONAL MUTANTS BY PCR FROM ｉｎｓｅｒｔ See note [9] in appendix.MATERIALST4 polynucleotide kinase (New England Biolabs)Sephadex G-15 resin (swell in TE buffer), glass wool, 1 ml syringes (for making spin columns)Gene-specific primer(s). We typically ｓｅｌｅｃｔ two primers, one for each template strand, for every 200 bases to be analyzed. Primers are designed to have annealing temperatures in the range of 65-72 C to reduce nonspecific priming in the PCR.ｉｎｓｅｒｔ-specific primerFor mutants generated with the MLVNotBsgG/B, the ｉｎｓｅｒｔ-specific primer is shMLVNotBsg (5'-GGCCGCGTGCAGCTTTCA).Radioisotopes.gamma-32P-ATP (10 uCi/ul), for end-labeling PCR primersalpha-35S-ATP, for making control sequencing ladders, which are used as size standards for footprinting PCR products. (Also need reagents for making sequencing ladders).PCR Reagents -- see Materials section within "Generation of Insertional Mutants"MATERIALS FOR DENATURING POLYACRYLAMIDE GEL ELECTROPHORESISUrea40% Acrylamide (19:1)Formamide gel loading dye95% v/v deionized formamide20 mM EDTA0.05% w/v xylene cyanol0.05% w/v bromophenol blue20X TTE=Glycerol-Tolerant Gel Running Buffernote: traditional TBE buffer can also be used for this type of analysis gel.216 g Trizma72 g Taurine4 g disodium EDTA (2 H2O)qs to 1 liter1) LABEL GENE-SPECIFIC PRIMER WITH 32P10 ul 10X T4 Polynucleotide Kinase buffer (New England Biolabs)1 ul gene-specific primer (100 pmol)10 ul (100 uCi) gamma-[32P]-ATP (3000 Ci/mmol)5 ul (50 U) T4 Polynucleotide Kinase Enzyme (New England Biolabs)qs to 100 ulIncubate kinase reaction at 37 C for 1 hour. Heat inactivate kinase at 65 C for 20 min. Purify labeled oligonucleotide away from unincorporated label by spin column chromatography through a 1 ml bed of Sephadex G-15 (Pharmacia). Specific activity should be approximately 800,000 cpm per pmol of oligonucleotide.2) PCR ANALYSIS OF MUTANT LIBRARIES2 ul 10X PCR buffer2 ul 10X MgCl2 (20 mM for shMLVNotBsg)0.4 ul ｉｎｓｅｒｔ primer (shMLVNotBsg, 10 uM stock)0.3 ul gene-specific primer (10 uM stock)ul 32P-labeled gene-specific primer (1.0 pmol)ul template DNA (approx. 20 ng)0.1 ul AmpliTaq (0.5 U)in a 20 ul final reaction volumeThermocycling conditions2 min at 94 Cfollowed by 15-20 cycles of30 sec at 94 C20 sec at 68 C (annealing temp varies)30 sec at 72 C3) DENATURING POLYACRYLAMIDE GEL ANALYSIS OF PCR PRODUCTSAdd 20 ul of formamide gel loading dye to PCR reactions. Heat samples to 95 C for 3 min before loading onto a prewarmed 6% or 8% polyacrylamide sequencing gel, containing 7 M urea and 1X TBE (or 1X TTE) running buffer. Bands are sharper if 1X TBE is used, but the glycerol-tolerant buffer 1XTTE must be used if also analyzing mutants by the restriction endonuclease method described below. A 35S-sequencing ladder made with the same template and gene-specific primer combination serves as an appropriate molecular weight marker for footprinting lanes. Gels are run at approximately 70 W for 2-6 hours. ANALYSIS OF INSERTION OR REPLACEMENT MUTANTS BY RESTRICTION ENDONUCLEASE METHOD See notes [10] and [11] in appendix.MATERIALS-- See "MATERIALS" sect