Mouse p27 PCR Using Gitschier Buffer

Mutant allele: Neo-1 primer (CCTTCTATCGCCTTCTTG), plus mgK-3 primer (TGGAACCCTGTGCCATCTCTAT) produce a 0.5kB PCR product.

Wildtype allele: mgK-3 (above) plus mcK-5 (GAGCAGACGCCCAAGAAGC) produce ~1kB product.

Stock Solutions:

1 M Tris pH 8.8 (do not use pH meter, store at room temp.) 1.23 g Tris HCl 5.13 g Tris base q.s. 50 mL with H2 O

KG-1 (10x) (Store frozen)

q.s. to 50 mL with H2O and aliquot into 1.5 mL eppendorf tubes

PCR Reaction Mix (To make a fresh master mix, multiply # PCR reactions x volumes, below)

2 µL KG-1 (10x) 1x 2 µL KG-2 (10x) 1x 2 µL Primer 1 (1uM) 0.1 mM 2 µL Primer 2 (1uM) 0.1 mM 0.2 µL Taq (Gibco) (5 U/uL) 0.05 U/mL 10 µL H2O 1.8 µL DNA 20 µL Total

Cycling Parameters: It is important to not place the tubes on the machine until the block has heated to > 90ºC.  The first 4 cycles employ a higher melting temperature which helps to denature genomic DNA.  Subsequent cycles use a lower melt which is sufficient for PCR product and preserves enzyme function.  Longer (2 min.) extension times should be used if products > 2 kb are being amplified.

95°C hold x 2 min.  (while inserting tubes) (96°C x 30", 57°C x 30", 65°C x 1-2') x4 (93°C x 30", 57°C x 30", 65°C x 1-2') x36 4°C hold